Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0856
Clone ID AD0856
Vector pGT0lxr
Project sanger

Sequence tag AD0856
Sequence
TGGCTCAGGGAAAAGCACGTTCTTGCGCATGCTGGCCGGGAAGCCACCGGTGGAAGGCCACGTCCCTACCTGGGGCTTCA
ACTCTGTTCGGCTGCCTACCAAGAATTTCGAGGTGGACCTGTTAGAGATTGGTGGCAGCCAGAACCTGCGCTTTTACTGG
AAGGAGTTTGTCAACGAGGTGGAGGGGGGTGGTGTTCATGGTGGACTTGAGTGACCGGCTATCGGCTACCGTGGGCTCGG
CAGCACCTTCAAAAAGTGTTGGGCGGGCATCTCCAAAAGCGTTTTTTTTTTTTTTTTACCCCA
Sequence Type mRNA
Unitrap ID UNI2125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54677182..54680294 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025870 (Arl10) NM_019968 ADP-ribosylation factor-like 10 Gene [Source:MGI Symbol;Acc:MGI:1930788]

 
Come back to gene ENSMUSG00000025870


For any suggestions or comments, please send an email to unitrap@crg.es