Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12981F11
Clone ID IST12981F11
Vector VICTR76
Project tigm

Sequence tag IST12981F11HMF1
Sequence
ACACAAACACACACCCCCATCTCCTACTGTACAGAGACCAANAACAGAAATCGTTTGTAAATAATGAACCTTATTTTTTA
TTATTGTCAATCCCCTAAGATATTGTATTTTACAAATCTCCCTCCCGTCACCTCTCCCTTATTTTGTATTTTATGAAGTT
AGTGCGGGCTTTGCTACCCCTTGGCCTGGGGAANAGGGACACCCCACCCTCACCAGGCCTCTCCCTGCCGCTGCCCAANC
TGCTGGGCCTTTTTAATTTGCCNAACTGCTCCTCCACCAGCTCAGCACATGCTTTAANAAGGCAAAATTAAAAAAAAAAA
N
Sequence Type genomic DNA
Unitrap ID UNI14287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91822501..91822820 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027230 (Creb3l1) NM_011957 cAMP responsive element binding protein 3-like 1 Gene [Source:MGI (curated);Acc:Creb3l1-001]

 
Come back to gene ENSMUSG00000027230


For any suggestions or comments, please send an email to unitrap@crg.es