Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10321G8
Clone ID IST10321G8
Vector VICTR76
Project tigm

Sequence tag IST10321G8BBF1
Sequence
CCACACNGTCACCCGTGCAGCCTGCCCTCCGCGGAGTCCCGGAGCCAAGAAGGCTCCCGCCGGCGCCTGTGCCACAAACC
TCTCAGGCCAGGCAGACCCCCGTGCTCTCACCAGGAAGGTGGCCGGCTGTCTGGCGTTATTTGTTTTCTTGATGATGGAC
ATTCTGACTGGGGTGAGGTGGTTATCTCAAAGTTGTTTTGATTTGCATTTGAATGATGTTGAACAGTTCTGGAAGTGTTT
ATTAGCAATCTCTATTTCTTCTTTTGANATTTCTCTGCACATACCCATGCAAGCTTTTTGACTGGTTGATTTTTTTTTTT
TTTTN
Sequence Type genomic DNA
Unitrap ID UNI33813

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25953461..25953784 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037437 (Adam32) NM_153397 a disintegrin and metallopeptidase domain 32 Gene [Source:MGI (curated);Acc:Adam32-001]

 
Come back to gene ENSMUSG00000037437


For any suggestions or comments, please send an email to unitrap@crg.es