Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0564
Clone ID AD0564
Vector pGT0lxr
Project sanger

Sequence tag AD0564
Sequence
CCTTACTTTGTCTGTCTATCTTTACAAATTCGCGGGGCCTTTTTACCCTGTCTTATCTCGCGCTCTGTTTCCTTTCCTTG
CTCGTATTCTCCTTAGTTGCAAGTTGCACCCCCAGGCTGTGAATGCCAGGCCGCGGGGTAGCCGCTGCTACAAAACCCGC
CCAGGCTCAAGCCGGTCCCCCTGCCGCAGCGCCGCGCCCTTACCCGAGCCTTGGCCACTCTCCTGACTCGCACGCCGAAG
GCCAGACCCGCCCGGCGAGCCGTGTGGCCCTCTGGGAAGTGCTACCGTGCGCCTAGCGGACCCAGTTCAGCTTGCTCAGG
ACCTCCCCCATATAAAGAAGAGGAAATGACCGAGTCTGAG
Sequence Type mRNA
Unitrap ID UNI2128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30728510..30739097 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es