Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_250F9-3
Clone ID CMHD-GT_250F9-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_250F9-3
Sequence
GTGCCTCCGTCGACTGTGGAGTACCTGGAGAAACAAGGCATTGATGTGCGGGTCCTCCAGACAGAGCAGGCCGTGAAGGA
GTATAATGCCTTGGTTGCCCAAGGGGTCAGGGTAGGAGGTGTCTTCCATTCCACCTGCTGATGGCGCCTACAGAGGAGAA
TAAATCAGACCACAAAGCCTTGGCTGTCTTACCAGTCTCCACATCAACCTCCACTGTGTATTTTGAACATATGTTCATGT
TCTTGGGACAGATTGGTGGGAGGCTGAGGCACAGGTTTTGCACTCCAGGTTGCTTAAATCAGAGAAGAGAGAGGTTTGCT
GACATTTAATATTGTGCTATGTGTTAGGTTCAAAGTTTGAGAAACTTGATACAAAAATAAAGGTTGAAACTTGAAGGCC
Sequence Type mRNA
Unitrap ID UNI13793

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104698853..104699251 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035642 (1810020D17Rik) NM_183251 RIKEN cDNA 1810020D17 gene Gene [Source:MGI Symbol;Acc:MGI:1913523]

 
Come back to gene ENSMUSG00000035642


For any suggestions or comments, please send an email to unitrap@crg.es