Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11604C12
Clone ID IST11604C12
Vector VICTR76
Project tigm

Sequence tag IST11604C12HMF1
Sequence
AGACCNTAGCAGAAATGGATCAGGATGGGTCTACACAACCCACAGGAAGCAGAGGGTGGGCTGTCACTGCCGGAAAGCTT
TGGAGCGCANTAACCTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81999115..81999213 95
NO GENE  


Sequence tag IST11604C12HMR1
Sequence
TTAGCATTGGCAAGCTGGACATGGTGGCTTATACCTGTAATCTCAGCACTCAGGTGGCAGAGGCAGGAGGATTGATGCAA
GTTGTGGGTCAGCTAAGGCTATCTAGTAAGACCTGTCTCAGACAAGACAAGACATTGGATGGTCATACACTCTATTTTCC
TATTTTGGGTAATATTGCTTATGGTGCCTANAGTGGANCCCANANCCCTGTGCATTTCCATAAATACTGTGTCACTCCCA
ACTCTAGTGCATCAATTTCTTCNTCAANTTTAANAGTTN
Sequence Type genomic DNA
Unitrap ID UNI5488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81999213..81999490 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es