Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13156B12
Clone ID IST13156B12
Vector VICTR74
Project tigm

Sequence tag IST13156B12BBF1
Sequence
GCACCACCTTACATTCTCCAGGACACCAAAGGACTTGCTGGACCAGACAGCAAGCCCCTGAGTACTACTAGGCCAGGTAG
AACCTGCGAAGTGGGGGGCAGCCCCACTTTCCAGGTGGGGGCCTTTGATGCCTTCCCCAATGCTACAGGGCACAGGGAGG
CAGGTGAGCACAAGACAAGCAAACAGGTCTGGGCTGCTCAAACTGGCAGGTCCAAGGTTTANCAGCCCACCCTGTCTTTG
ACCTTGCTGCTATAGGACTTCAGGCCAAGGCTGACTTTCTTCTGANAAGGGGTTCCTGCTAGCCNGTGGCATATGTCNTT
T
Sequence Type genomic DNA
Unitrap ID UNI33816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25356891..25357210 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015083 (C8g) NM_027062 complement component 8, gamma polypeptide Gene [Source:MGI (curated);Acc:C8g-002]

 
Come back to gene ENSMUSG00000015083


For any suggestions or comments, please send an email to unitrap@crg.es