Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13614G3
Clone ID IST13614G3
Vector VICTR74
Project tigm

Sequence tag IST13614G3HMR1
Sequence
AGTACACGCTCTTTAACCNCTGAGCTGCCTCCCAGTCATCTCCTTCTGCTTCTTCTATGCTAGTTATCATTAACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI6667

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45565131..45565208 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]


Sequence tag IST13614G3BBF1
Sequence
TACTGTTCTTTGCANACAATCTGAGTTCAATTCCCAGTACCCTCATCANGCANCTCACCTATAACTCCAGCCCTAGGGGG
GGTCCAAAGCCTCTAGTCACAGAAGGCGCCCGTACTCATGTACAGATGCATAATTTTAAAAATAAAAATATATTTTTAAA
AAAGATTTATTTCCTGATAAACAGCTTNNNTGCNNTANCTGGATATAAAATTANCTNNNACAAANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es