Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_250E1-3
Clone ID CMHD-GT_250E1-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_250E1-3
Sequence
CTCCGTCCATTCCTATCTAAGGGCCAGGTTGGCCAGAAGCGCCATTGATGAGTACGGTGTGAACAAGGAAGTTTCACCAT
TCAAGCTTGACATCTTTAATTACCAGTCTCTGCAGAGTGGTACTGAAGCTCATGTGAAGGTTGGCGAATTTGTCTTTGAA
TCTCACAGTGTTCAGCATCTTTCACTAAATGATAAAATAATAACTTAGGGGTGAGCACCACAATCAGGTGAGAATCTTCA
AAGTCAACACTGTGTGTTTTTCTTAGAGTGGAATTTCTAAGATAATAGAGTTCAGGTGACTGCTGAGTGCCATCAGGCTG
AGAGTACCCTAACTTTGTCCTTTCCAGTGCTAAATACCTGAACTTTCTGCCTGCAGAATCACTGTAAGAATTACAGATTC
ATTTTGGACTAATTCTTCAGATGGTTCCATCCTTGAAATGATCATATACAGCTATGGCCTACCTCGAAAGAAAAAAGAAA
CAATCAACACTTGGGCAGTTACTTCCACTAAAGTTCTTGACCTGTATGATTCATCAAGAAAATAAACAGTCTCTGC
Sequence Type mRNA
Unitrap ID UNI13799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 123778035..123778588 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072779 (Vmn2r25) vomeronasal 2, receptor 25 Gene [Source:MGI Symbol;Acc:MGI:3644645]

 
Come back to gene ENSMUSG00000072779


For any suggestions or comments, please send an email to unitrap@crg.es