Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14742B8
Clone ID IST14742B8
Vector VICTR76
Project tigm

Sequence tag IST14742B8BBF1
Sequence
GTCTTCTGGTAGATTTTCATGCTGTGGTTTTTCATTCTCTCCTGCCCAAGATGCGAAAAGCATGAAAGGAATTTTAATGC
ACCAAAGTATTATACTGTTATAACGGTGCTCAGATGTAAACAGCAAAGACCTTCGGCCTTAGGCAGTTCCGGAGCTCGCC
CGGGAAGAAATGTACCCAGCATCCTTTGCTTTCTTACACAGAGACAAGGATAACCTTGCAAAGGCGGGCCTTATACAAAC
TATCTCAGAAACGGAGACAGGAAAATGCCTCTCTAGATTAAATCAGGGAAAATATGGAAATTTCAAAGATTGTTAGCTCA
CTGGAGCTGAAAACTTAATGGAAGGCANACTTCNNTANAGAGTANTGAAAACCCACCCTTTGGANAGCTTTCAACGTCTC
ANTTTANTCTCGTGTGAANCNNGNNGAGGCNNTCNNGCCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14742B8HMR1
Sequence
AGACAACATTTTCGTCCCGAATGAAGAGTCGCTCACACCTT
Sequence Type genomic DNA
Unitrap ID UNI25764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93012944..93012984 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036168 (Ccdc38) NM_175488 coiled-coil domain containing 38 Gene [Source:MGI (curated);Acc:Ccdc38-001]


Sequence tag IST14742B8HMF1
Sequence
GTCTTCTGGTAGATTTTCATGCTGTGGTTTTTCATTCTCTCCTGCCCAAGATGCGAAAAGCATGAAAGGAATTTTAATGC
ACCAAAGTATTATACTGTTATAACGGTGCTCAGATGTAAACAGCAAAGACCTTCGGCCTTAGGCAGTTCCGGAGCTCGCC
CGGGAAGAAATGTACCCAGCATCCTTTGCTTTCTTACACAGAGACAAGGATAACCTTGCAAAGGCGGGCCTTATACAAAC
TATCTCANAAACGGAGACAGGAAAATGCCTCTCTANATTAAATCAGGGAAAATATGGAAATTTCAAAGATTGTTANCTCA
CTGGANCTGAAAACTTAATGGAAGGCANACNTNCNTANNGAGTANTGAAANCCCNNCCTTTGGATANCTTTCNNCGTCTC
ANTTTANTCTCNTGTGANNCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036168


For any suggestions or comments, please send an email to unitrap@crg.es