Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12072C9
Clone ID IST12072C9
Vector VICTR76
Project tigm

Sequence tag IST12072C9HMF1
Sequence
TTAGTTTCAGTGTTGTCCTGGCTCCCTCCGTCAGAACACACATGTCCCGCCGGGGAACCGCACCAGCATGGCTGCCTTTC
CCAACCCCCCTTTTCCCCTTGCAGCCACATCAGCAGAGACTGGCTGTGGCCTGGGGTGACCCATCTCGGAGGATCTGGCT
GGCTACTGTGCATCTGAAGTTCTGGAGAAGTGTTCACCTCAGCCCTAGTTGTCCAGAAGGAAGCCCTGAGGCCAGCAGCT
GCCCCACTAGTGAACTCCAGGGTGTGGTTGATCCTACGACTCCCCGTGCTCCTTCCAGCAAACTCTCCTCAGTCTTGAGG
AGCTGGTATGGAGAAGAATTCAGCTCTCCAAGCTTAGAAGTCCTGANNGGTTCCTCATAACTGCACCAAGAGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI31031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79991796..79992189 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]


Sequence tag IST12072C9BBF1
Sequence
TTAGTTTNNGTGTTGTCCTGGCTCCCTCCGTCAGAACACACATGTCCCGCCGGGGAACCGCACCAGCATGGCTGCCTTTC
CCAACCCCCCTTTTCCCCTTGCAGCCACATCAGCAGAGACTGGCTGTGGCCTGGGGTGACCCATCTCGGAGGATCTGGCT
GGCTACTGTGCATCTGAAGTTCTGGAGAAGTGTTCACCTCAGCCCTAGTTGTCCAGAAGGAAGCCCTGAGGCCAGCAGCT
GCCCCACTAGTGAACTCCAGGGTGTGGTTGATCCTACGACTCCCCGTGCTCCTTCCAGCAAACTCTCCTCAGTCTTGAGG
AGCTGGTATGGAGAAGAATTCNGCTCTCCAAGCTTAGAAGTCCTGANNGGTTCCTCATAACTGCACCAAGANCTGGCCNT
GGTGACGCATGCNNGGCAAGANGCGAGGGTGCCNTGAGCCCAGTGACNACCTGGNCTACACTGGGGGTTCAGTTCAGCCT
GAGTTACATAGCAAGACCTTGTCTCAGANCAAACAAACNAACAAACCAAAAACCNNAACAGAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI31031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79991796..79992342 509
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es