Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10951D5
Clone ID IST10951D5
Vector VICTR76
Project tigm

Sequence tag IST10951D5HMR1
Sequence
NGGAAGGGTTTTCAGTGTCCAGAATACTCACTAGTGAGTAAAGTTGATATTTAGGAGAGTTGATAGCATTCGGGCGCAGC
CTGTGACAGGAATGTTGAAGCAAAGTCGATGTTCTTTGTCTTTGTGTGGAATGCAGGTTTTTGGTGTGGAAAATGTCCCG
TTTTGTAGTTTGAAAACATTAGCTTTATGTTTGCTTTTCTTGTGAGCGANAGGTCAGTAGTGTCAGGGGCCCNGNANAN
Sequence Type genomic DNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129650618..129650848 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es