Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12326F12
Clone ID IST12326F12
Vector VICTR76
Project tigm

Sequence tag IST12326F12BBF1
Sequence
GCTTAGTGTTCCTGTGGGAGAGCAGGGAGACCAGGTGACCCCAGAGGGCAGGAGCCAAGGGTGGAAGGCACCGGGCCAGG
TCAAGGTCTGGATCTGAAGAGCAGGGGACAGAAGTGCAAACTGTTCTGAGTCACAGTTTCACAAAATCACCTTGTCTGCT
GGGCAAAGAGCAGACTGCTGTGACCAAGGTCTGGAGTGAGGACACCTGCTGGAGAGGGTGGTGGCTGGGCCAGGCTGCTG
AGAAGCATCTGAGTCTGAAGATGGTTCAGAGGCGGAGGAGCCAGCATGTGTTGGCAGATGCTTGGTGCATCCTTTCTTTA
TATATATATATTAGGTATCTTCNNGCACACCAGAANATGGTAACAAATCCCATTACAGATGGTTGTGAGCCACCATGTGG
TTGCTGGGAATTGAACTCANGATCTCTGGAANANCANTCAGTGCTCTTAATCGCTGANCCNTCTCCCCAGCCCTCTTTTN
AANTTTTTNAANGGCTATTTATTTTAATGTGN
Sequence Type genomic DNA
Unitrap ID UNI11133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132291643..132292152 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028885 (Smpdl3b) NM_133888 sphingomyelin phosphodiesterase, acid-like 3B Gene [Source:MGI (curated);Acc:Smpdl3b-001]


Sequence tag IST12326F12HMF2
Sequence
TTAGCAGGGAAAGCACACCTCTGCCTTACCCAGGTCTTCCAGCTTCCAGATCATAAGACTCACTACCGAGAGTTCCAGTT
GGAACAACTTATTGGGTGCCAGCAGGGCACTCCTTGGCATACCATGTCTGTGAGCCCCACTGGGTATTCCCTCAGAGGAT
GTCAGCACCGTGATACGTCCTAGTAAATCCTGGAGGAGCCTGCAGCTCAGAGAGTCCTAAGTCACTTACCTAAGGTTACC
TAGGTAAGAAGAGAGAGAGCCAGGATTTGAACACACTATCTGGCTCCATATACCAGGCATTTAAGTACTATCAGTGTGAT
GATGATGATGATAGCTGTGATTAAAATGACCCTTTATTGATCACATACTATGTGCCTAGCCCCAGGCTAGGGGTCCATCT
CATCAAATCCATCTGATGCTGTACAACAAGGATTTCTAGCTCTGCTGTCCAGANGTCGAGCTAANGTTCAGGANAGGGAG
GCCTTTGCTGGANGCCACCTGGTTN
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26060249..26060750 494
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es