Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14937C7
Clone ID IST14937C7
Vector VICTR76
Project tigm

Sequence tag IST14937C7HMR1
Sequence
CTTTAACTGATGTAAAATCAAATTCTTTCCTGTCACATCTTTTCNCCCCAAATTTTGATAACATTTTACTAACATTATTT
ATTAATTTGTGGTGTGTGTGTATGTATGTGTGCTGTGTAGTGTGACATATGTGTGTGTGGTATGTGTGTGTTGTATGGTA
NGTGTGTGGTGTNANTN
Sequence Type genomic DNA
Unitrap ID UNI21463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11734719..11734890 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]


Sequence tag IST14937C7HMF1
Sequence
TGTCTAAATTGAGTGAGAGCTGTGCCCCTTCCTGTTTTAAAGTAAAATATCATTCATTTAATTATATTATACACTGAGCA
ACTTTGCAAAGTAAACATATTGAAAACATTAACCTTACATACTAACAAAATTCAAGCAAAAGCTTTCCCCTGGTCACGTG
AGTGATTAATCAATTTCTTACCCTGATTTTTTTTTTTNANTTTAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11734953..11735157 201
NO GENE  

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es