Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14558G12
Clone ID IST14558G12
Vector VICTR74
Project tigm

Sequence tag IST14558G12BBF1
Sequence
TAACGTAGAATGCTTTGGAATGGTTGAGGCAGATCAGAGCCACCCACCTCTTCCTAGGCCACTGGGTTAAGAGTTAACCA
CCGTGAGACACTGTTAATTTTAAGGGTATCTATACTGTGAGCACCCTTTTATGTTTATTTTTCCTTCAATTCGACTCTCT
AATTAGACAACTATTAGACTCTTCCCTAGTGCCATCACTATTGTGAGCAGTCAGCTGAGTGCATATTGCCACTACCAATT
GTTTTGAACACTCTATTCTAAACACAGGAGCTTTGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9156555..9156830 276
 
EST/CDNA Est Name
  CA878110.1 - CA543388.1 - BY306928.1 - BY010871.1 - CJ181679.1 - BY015746.1 - BY020013.1 - BY134671.1 - BY333136.1 - BY089695.1 - BY079961.1 - BY777656.1 - BY134277.1 - BY126106.1 - BB844499.1 - BY124486.1 - BY780819.1 - CN461132.1 - BY773942.1 - BY781560


Sequence tag IST14558G12HMR1
Sequence
AAGCACAAAGTGTTCCTATATGAAATTGTAAGTACTTCTGAAGATATTATTGTGTAGGCTTGTATGTTTTCTAACACTTT
TATATGTACCTAGGTATGAGATTTAGGAATTTATTATCTGCCAATAATTTGCTGCTTGGCAGAGTTTTGTTCCTTTAGGG
AAAAAACATTAAACGTGTTTTTTAAATTACACATTAATAGATACATTTTCTTTTAAATATTGCCTAAGGTGGTGTGTGTG
TGAGGGAGGGAGGATGAAGGANGACTATGTTAGGTTTGNANGTGTTCATTAAGGAGCTCTGTAAATACTGTANCCTTNNN
CACTCTCCCCCAACANTTNCTGACTATACNNNTATTTTANNCNTAN
Sequence Type genomic DNA
Unitrap ID UNI6927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9156197..9156555 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]


Sequence tag IST14558G12HMF1
Sequence
TAACGTAGAATGCTTTGGAATGGTTGAGGCAGATCAGAGCCACCCACCTCTTCCTAGGCCACTGGGTTAAGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9156555..9156629 75
NO GENE  

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es