Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_249F1-3
Clone ID CMHD-GT_249F1-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_249F1-3
Sequence
GAAATACTAAAGAATGAAAAGTACAGAGAAGAAATTAAAATAAAAAGCCAAGATTTTTATGAAAAAGATAAACTCGGTAA
AGAAACCAGTGAAGAACTCTTGCCTTCACCTACTGCAACTCAAGTTAAAGGGCACGCCTCTGCCCCGTATTTTGGAAAGG
AAGAGCCCTCAGTGGCTCCCACCAGCACTGGCAAGACTTTTCAGCCAGGATCCTGGATGCCAGAAGATGGCAAAAGACAA
AGTCAATGAATGACAAAGTCAATGAATGCCCTGCCCTGAAGTCATAGCATTGTAAGGATATGGCTGTTTTAACAAATAAA
AGGTTAAAAGTC
Sequence Type mRNA
Unitrap ID UNI2100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108842881..108843148 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068184 (Ndufaf2) NP_001120818 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 Gene [Source:MGI Symbol;Acc:MGI:1922847]

 
Come back to gene ENSMUSG00000068184


For any suggestions or comments, please send an email to unitrap@crg.es