Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14639G11
Clone ID IST14639G11
Vector VICTR74
Project tigm

Sequence tag IST14639G11HMR1
Sequence
CATGGACGTATATAAAACTAGATTCGTGGGTGTTTAATTTGGGCAGGTTAGCTTGAACCAGTGGGTAATGAATTCCCTTT
TTAGGATCTGTATTATGAGATATGTGCAATCCTTGGGTGACATATTTAAGTGAGCCCACAAATATTAAACACATGACATT
ATCTGTAGCTGTGTGTCACATTGTANACATCANTNNTTC
Sequence Type genomic DNA
Unitrap ID UNI15567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175545338..175545529 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]


Sequence tag IST14639G11HMF2
Sequence
TGCNTAATTAATACANNNNGNGAAATTACAAAATCATTCTCACTGCCCTAATCAGGCCCTTCTCGATAACAGTGGCCCCT
GCAGCATACTCCCCTTTCCTTTGGTCTGTGACCTAGCTCTTGTCAGCACTGTTTTACCTGACAGTGTACACAGTAAGCTG
TTCCTCTGGTTCTCATCCTGCCAAGTGTATTTCCACACACAAGCCCCTGCCACAAAGGTTTTTTCCAGTGCAGTCTTATA
NTNNNNNTTACTCANAGGCCACAGCCTGGTCCAAAAGGAGAGACTAGGTCCACAAAAGACCTCATAGGTGGCCCCATCTG
TCTGGCTGATGCTTACNATCCTGGCTCTGGGAANACCTANTNCACAGGCATCCTTTGCTANNATGCTAGCTCCTCCCTCT
TTGTGGNACATGACNCTGCACTTACCANGTGTGAAGTTCTNNNCTTGCNTGAGCNANATTCANANCNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14639G11BBF1
Sequence
CATGCATAATTAATACAATCTGTGAAATTACAAAATCATTCTCACTGCCCTAATCAGGCCCTTCTCGATAACAGTGGCCC
CTGCAGCATACTCCCCTTTCCTTTGGTCTGTGACCTAGCTCTTGTCAGCACTGTTTTACCTGACAGTGTACACAGTAAGC
TGTTCCTCTGGTTCTCATCCTGCCAAGTGTATTTCCACACACAAGCCCCTGCCACAAAGGTTTTTTCCAGTGCAGTCTTA
TAATAAAGTTACTCANNGGCCACAGCCTGGTCCAAAAGGAGANACTAGGTCCACAAAANACCTCATAGGTGGCCCCATCT
GTCTGGCTGATGCTTACCATCCTGGCTCNGGNANNACCTANTACACAGGCNTCCTTTGCTAANATGCTNNCTCCTCCTCT
TTGTGGGACATGACACTGNNCTTACNATGTGTGANGTTCNGANCTTGCTTGAGCTAAATTCANNGCATCNANCGAANACN
CTAANAACAGATCACACNGNNACACTGANANCANCTGANTTNCNCNGNNAANCNTGCAGGCTTGGTANNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000078893


For any suggestions or comments, please send an email to unitrap@crg.es