Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12978E7
Clone ID IST12978E7
Vector VICTR76
Project tigm

Sequence tag IST12978E7HMF1
Sequence
CAACACAAAACATAGAACATTCATTCATACAGACTGGACACGAACATACATGAATTGAACACGAGAACAGATTGGTGCAC
CGGACATTANACAAGACACAAAAGGGAACAGAGTACTCCTGCTATAAGGCCCAGAGAGATATTTCTCTCTGCTTTTTGGG
ACATTTTCCTCCCTTATGATGCATCTTTTATTAACTGGGGCAATCCGCCTATTCCTTTTAATAAACCCTTTCTTTTCTCA
CACCTCATGTANCTTCGGAGAGCTACGGCCTACCGCCTATTACCCANCTCCTCACTGCTGAACCTANNTGAACCNNCGCT
CGGGTTTAACGCTGTCTCANCTTANCCNANACCTTCTCCGGTNTGAATTTCCCTTATCCNNNANTTNATGGAGCTCCNAN
CNANCANCGTCTCTTCCNNAAATCCNTTGCCGTTTCTCANTCNNGNGTTGGTTCGCCNANTGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 166559..167047 299
NO GENE  


Sequence tag IST12978E7BBF1
Sequence
ACAACCATCCCTAACAAGATCTGTCGAGGTCGATCGACGGTATCGATTANTCCAATTTANCGANAACAGATTGGTGCACC
GGACATTANACAANACACAAAAGGGAACAGAGTACTCCTGCTATAAGGCCCANAGAGATATTTCTCTCTGCTTTTTGGGA
CATTTTCCTCCCTTATGATGCATCTTTTATTAACTGGGGCAATCCGCCTATTCCTTTTAATAAACCCTTTCTTTTCTCAC
ACCTCATGTANCTTCN
Sequence Type genomic DNA
Unitrap ID UNI32369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 113588343..113588537 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29594506..29594700 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8738395..8738589 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 81748330..81748524 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 129010171..129010365 185
NO GENE  

 
Come back to gene ENSMUSG00000046634


For any suggestions or comments, please send an email to unitrap@crg.es