Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11558B4
Clone ID IST11558B4
Vector VICTR76
Project tigm

Sequence tag IST11558B4BBF1
Sequence
TCTGTTTACAGAAATCCAAACAGATATGTAGACAAACACTCAGTCANAGTCAAAGGCTTCCAGACACAGCATGTAAAGAG
AAGCTGTATTGATTCCTAAGCAACAAAACAAACAAAAGAGGTAAAATTTCTAGGAATTATCCAATAAAAGATATGAAGGG
CCTCTACGTGGAAATTTAAAAGCTTGAAAATGTGAANAGGTGGACAACTCCNTCTGTGATTTATCCNCTGGCTTAANATC
TGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119492276..119492518 233
NO GENE  


Sequence tag IST11558B4HMR1
Sequence
ACTNGGAATCCTNTGGTAGGATNAGGCCTCTTCTTTAACTTGCAAAGTGAGCACTGTTTACTCTCTCTTTCTCTGCCATA
GGGTCTCTTACTCTATAGCTCAGGTTGGCCTTGAGCTCTTGGCAATCCTCCTGCCCCAACCTGCTGAGTGCTGGGATGAC
AGGCCTGACACTTGCCAACAGGCTGTGCTCCANAGCAGGTCANAGTTCCTANACTANCAAGAAGGGGTGAGTTCTGGATG
ACTTTATCAAACAGCACTATGGAATGGCCNGN
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119492579..119492847 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es