Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_239C5-3
Clone ID CMHD-GT_239C5-3
Vector pGTNMDi
Project cmhd

Sequence tag CMHD-GT_239C5-3
Sequence
AGACGGAAACAAAAAAGGCAGAAGGACCTGCTAAGGTTCAGAAGCTGAGATACTGTGAGCGTCTGGAGTCCCTGGCCGCC
AAGCTCTTCTTGAGGGCCTATCACCAGGCTCTCAGCAGGGTTAAAGAGGTCACACAGGTCAGGAGACCATTACTCAGCCG
CAGAAAATGAAGGAATCCTTAGATGAAGTTATGGATTACTTTGTTAACAACACGCCTCTCAACTGGCTGGTAGGTCCTTT
TTATCCTCAGTCTACCGAGGTGGACAAGGCCAGCCTGAAGGTCCAGCAGTCTGAGGTCAAAGCTCAGTAAACCCCTCCTT
GTCCCCAGTGCATGATGTTGCTGGACAGGTGACCCCTTTTGCTGTATTGAAGTTAACCTTGTAGATGGCTTTAGCTTAGA
TAAGCAGCTTCTTAGAACCAAAGGCCTCATTATGGTCACTCACAGCTCAGTTATGGTCTTGCCCCAGCTGGCCCTGGCAC
AGGAGTTCTCTTACAGGTGAGTGGCCTGTGTTAGTCTTGTGAGGACCTCGAGGAACCTAAAAGCTCAGATGCACTTACAG
TCTTGTCTGTGGCCTTTGTATTGTTATTGGCTGTAAACATCTGTCTGGACCGAATAAAG
Sequence Type mRNA
Unitrap ID UNI13810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86272773..86273391 617
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081169 (AL824707.7)  

 
Come back to gene ENSMUSG00000081169


For any suggestions or comments, please send an email to unitrap@crg.es