Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14607D6
Clone ID IST14607D6
Vector VICTR74
Project tigm

Sequence tag IST14607D6HMF1
Sequence
GGTCCCACATGGCAGCACAATGACTGCTACAGAAACTGTCCTCTCATTTACAAAGGTACTGTGTGTGTGCACTTCTGTAC
AGGTACAGGAAACACACACCATTTAACCAGGCTGGCCTCAAACTCCCTGAGACCTATCCGCCTGCTTCTGATTCCCAAGT
GCTGGGATTAAAGTTGGATTAAAGTCACCACCACCACCACCATTGGTTAAACACGTATTTTTAAAAGGAGAAAGAGAAGG
GGCTCTGCAGGCTAGGGAGTGCAGTTCACTGGTACAGGACACGCCTAGCATGCATGAAAGAAGCTATGGGTTCCATCTCC
AACACTATAAAACAAAAGGAAAGTAACTGCGAGGGAGGACAAGCAGAGACAGCACAGTACAAGTAGGTAGAAATTCCACA
GGCAAGGAGTTGAAAGGGCACCAGGAAGCCTGGGCCACCCAGCTGGACGGACTATCACAACCATCTCGACTGCCCGANGN
CATCCTTCAACTGANATAACTGAACCCCAGANGGANGTGTATGTCACAGCTGANTCNCTNNNCNTCACGTANCCNANGGC
TCTGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249373..17249938 538
 
EST/CDNA Est Name
  BY127907.1


Sequence tag IST14607D6HMR1
Sequence
GACCCACCTATTAAGCTCAGTTGGTCAAGCGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249935..17249969 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


Sequence tag IST14607D6BBF1
Sequence
GGTCCCACATGGCAGCACAATGACTGCTACAGAAACTGTCCTCTCATTTACAAAGGTACTGTGTGTGTGCACTTCTGTAC
AGGTACAGGAAACACACACCATTTAACCAGGCTGGCCTCAAACTCCCTGAGACCTATCCGCCTGCTTCTGATTCCCAAGT
GCTGGGATTAAAGTTGGATTAAAGTCACCACCACCACCACCATTGGTTAAACACGTATTTTTAAAAGGAGAAAGAGAAGG
GGCTCTGCAGGCTAGGGAGTGCAGTTCACTGGTACAGGACACGCCTAGCATGCATGAAAGAAGCTATGGGTTCCATCTCC
AACACTATAAAACAAAAGGAAAGTAACTGCGAGGGAGGACAAGCAGAGACAGCACAGTACAAGTAGGTAGAAATTCCACA
GGCAAGGAGTTGAAAGGGCACCANGAAGCCTGGGCCACCCAGCTGGACGGACTATCACAACNATCTCGACTGCCCGAGGA
CATCCTTNAACTGANANAACTGANCCCCNNNNGGAGGTGTATGTCACAGCTGANTCACTNNGCNTCNCGTAGCCCNNNGN
TCTGGGAGANANNANTGCNACTTCCCTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es