Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12801E6
Clone ID IST12801E6
Vector VICTR76
Project tigm

Sequence tag IST12801E6HMF1
Sequence
GTGGTAGGAATTCCACCGCCCCAAGTAAGGTAAAGACTGCCAGTGAGCAGTGTTTAGCAATTCTGTTTGCCATGATCGTT
GCTCCANAAAAATTCCATACTTCCTTTGAGAAAAGGAGCTGGGAGGAAAGGCAGGAACATAGCGCCGGCTACATAAGTAA
CTCCGTTTATACTAGGGCTGAGGCTGTGTCTTGGTACTACGGGTAGAGCGCTTGCTTGCCCAGTTTGTATGAGGACCTGA
GTTCACTCCCTCACTCTGGCACTGCAACAAAAGTCTGGATTCCCTCANCACAAGCCTTTACTCTANCACTCTGGACGGAN
AATCNAGGGGATCAGTAGCTCGAGGTCACCTTTGGCTACATATACAGTGTAAGGCAGTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62654782..62655163 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]


Sequence tag IST12801E6BBF1
Sequence
NTGGNANNANNNNNNCCGCCCNNANNNNNGNAANNANNGNNNNTNANCNNNNNNNANCAATTCNGTTTGCCATGATCGTT
GCTCCANAAAAATTCCNTACTTCCTTTGANAAAANGANCTGGGAGGAAAGGCNNGAACATNACGCCGGCTACNNAANTAA
CTCCGTTTATACTAGGGCTGAGGCTGTGTCNTGNTNCTACGGGTAGAGCGCTTGCTTGCCCAGTTTGTATGAGGACCTGA
GTTCACTCCCTCACTCTGGCACTGCAACAAAAGTCTGGATTCCCTCAGCACAAGCCTTTACTCTAGCACTCTGGACGGAN
AATCAAGGGGATCAGTAGCTCGAGGTCACCTTTGGCTACATATACAGTGTAAGGCAGTCTGGCCNACAGAANACCCTGTC
TCCCTCTATTTTTTTTTCTTCTAAGAGCCNTATANTTTAAAGATTTTTTTTGTTTTTTGANACAGGGTTTCTCTGTATAG
CCCNGGCTGTCCTGNAACTCACTTTGTANACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es