Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0533
Clone ID AC0533
Vector pGT0lxr
Project sanger

Sequence tag AC0533
Sequence
AGGAGCTGCGAGTCGGTGATATCCCCCAGTACTCCCAGCTGGTGCTGAACGTCTGTGAGACTCTCCAAGAAGAGGTGATT
GCACTCTTTGATCAGACCCGCCACAGCCTGGCATCCGACAGCGCTGCCGAGGACAAGGACAGCATGGAGACAGATGACTG
CCCTCGGCCCCGGCACAAGGACCAGCGTGATGGGGTGTGTGTCCTGGGACTGCATCTGGCTAAGGAGCTCTGTGAGGTGG
ATGAGGATGGGGACTCATGGTTGCAGGTGACCCGAAGGCTCCCCATTCTGCCCACGCTGCTCACCACGCTGGAGGTGAGC
CTCCGCATGAAGCAGAACCTGCATTTTACTGAGGCTGCGCTGCACCTGCTCCTCACCCTGGCTCGAACCCAGCAAGGAGC
CACAGCAGTGGCTGGAGCTGGCATCACCCAGAGCATCTGTTTGCCCCTCTTGAGTGTATACCAGCTTAGCAGCAATGGCA
CAGGACAGACACCTAGCACCTCTCGAAAGTCCCTGGATGCCCCATCCTGGCCAGGAGTCTACCGCCTGTCCATGTCCTTA
ATGGAGCGATTGCTCAAGACTCTACGCTACAATTTCCTGACGGAGGCTCTAGACTTTGTGGGTGTCCATCAAGAACGGAC
CTTGCAG
Sequence Type mRNA
Unitrap ID UNI2135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30192738..30196267 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es