Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10002H4
Clone ID IST10002H4
Vector VICTR76
Project tigm

Sequence tag IST10002H4BBF1
Sequence
AGGCACAGAACTAGTCCTAGGGGGTTGGTTTTGTTTCATTGTCCTGCTAATAGTCTAAATACTTTTCAAAGTGAAATATG
TATCTCTAACTTCCTTTCCAATTGGCTGGAGCAGGATGGAGCCTGCCTCTAGACCACATGGCCGCTGGCCCACCCAGTCT
TCACTACACTCTTACCTCACAGCTGACTCCTAGGAGCTTTGGCCTTTGTAACCCATGGACCCTGCTGATCTTGTTCTCCC
AGCATGCCCCAGTCTCCTACCTCTCCCTTTCTTGCTCCCTGCTTCTCTGGCTCTAAATGCTGTCTCTCGTGCATGCTGCC
TCTTTTCAGAACGTCTTGTTCCCTTGCCTGCTTCCCTCCCATAACCCAGAGCCCGGGCAGATACACATTTGGGGAAAGAA
GGCGGATGGCATGCCACAGGTTGAAGATTTGGAAATAATGGTAAAAATAAGAACTGACAAACCCAGGAAGTCAGGATCTG
GCTGGGGAGACATTAGTTGTGGAGCGCTTGCCTAGAAGCATGGGGCTCCCTGGTCTCCATCTGA
Sequence Type genomic DNA
Unitrap ID UNI33829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5705238..5705782 541
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024936 (Kcnk7) NM_010609 potassium channel, subfamily K, member 7 Gene [Source:MGI Symbol;Acc:MGI:1341841]


Sequence tag IST10002H4HMF1
Sequence
AGGCACAGAACTAGTCCTAGGGGGTTGGTTTTGTTTCATTGTCCTGCTAATAGTCTAAATACTTTTCAAAGTGAAATATG
TATCTCTAACTTCCTTTCCAATTGGCTGGAGCAGGATGGAGCCTGCCTCTAGACCACATGGCCGCTGGCCCACCCAGTCT
TCACTACACTCTTACCTCACAGCTGACTCCTAGGAGCTTTGGCCTTTGTAACCCATGGACCCTGCTGATCTTGTTCTCCC
AGCATGCCCCAGTCTCCTACCTCTCCCTTTCTTGCTCCCTGCTTCTCTGGCTCTAAATGCTGTCTCTCGTGCATGCTGCC
TCTTTTCAGAACGTCTTGTTCCCTTGCCTGCTTCCCTCCCATAACCCAGAGCCCGGGCAGATACACATTTGGGGAAAGAA
GGCGGATGGCATGCCACAGGTTGAAGATTTGGAAATAATGGTAAAAATAAGAACTGACAAACCCAGGAAGTCAGGATCTG
GCTGGGGAGACATTAGTTGTGGAGCGCTTGCCTAGAAGGCATGGGGCTCCCTGGTCTCCATCTGAAGTACAGAT
Sequence Type genomic DNA
Unitrap ID UNI33829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5705238..5705791 554
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024936 (Kcnk7) NM_010609 potassium channel, subfamily K, member 7 Gene [Source:MGI Symbol;Acc:MGI:1341841]

 
Come back to gene ENSMUSG00000024936


For any suggestions or comments, please send an email to unitrap@crg.es