Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10895E3
Clone ID IST10895E3
Vector VICTR76
Project tigm

Sequence tag IST10895E3HMR1
Sequence
CTACTTTCTTTATGTCNTGTAGTTAAAACTTGCTTTGAACTCCTCTTCCAGCCTCTGCTGCCCAGGGCTTGGAAAACAGT
CCTACAACTGCTTTCAGGCTGGGTTCTGACTGATCAGTGAGACAAAAGACACCAGGGAATGAGTGTTGTCTAACCTCCCT
GGGTTACAGGGTTACAAATTAGGGGATTACAAATAAAGAGGGACNGGTNNNANGTTGAGTTCNCNGNCCN
Sequence Type genomic DNA
Unitrap ID UNI15567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175547356..175547584 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]


Sequence tag IST10895E3HMF1
Sequence
NTANGAGCTACAGGAGATGTTTCTCTAAACAGACAGATATGAAATCTCTTTAAAAATAGGAATGAAATTCTTAATTTTGG
GGAAATATTGGAGAATAGAAACACGTAAGACGTCAAATCACCTATGCATAATGAAAATGAAATTCANAAATGTAATACCA
AAATTTAATATTTAAAAAGATCAATATAATTGAAAAAATATATTCCTGTACTGATTTGAAAAAGANCANGCCCTTCCTGG
TANAANGAATGTCATTAATAANATANCATTTGACCTTGCCCCTATGTGCTTTGTTC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177685937..177686230 278
 
EST/CDNA Est Name
  BY255196.1

 
Come back to gene BY255196.1


For any suggestions or comments, please send an email to unitrap@crg.es