Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10111F1
Clone ID IST10111F1
Vector VICTR76
Project tigm

Sequence tag IST10111F1HMF1
Sequence
TCACCTTTAACCTCCAGGCCAGGTTACCTCAAAAGAGTGGTAACCCCTGTAATCTCACACCTGTAAACCCAGCAATTAGA
AGGCTGAGGCAGGAGAATTTCTGTGAGTTCCAANCCAGCCTGTACTACAAAATGGGGGGGGGGGTNTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28093543..28093687 143
 
EST/CDNA Est Name
  AA874679.1


Sequence tag IST10111F1BBR1
Sequence
GTGAAAGTCTTAATGTCCATATTTCACTTTCTTGCCCTGTATCATCTCTTGGGCCCTAGGTTCTTCTTTTTTACATGCAT
ATTCTCACTATGTAGCCCAGGCTAGCCTAAACTCACTTGAACTCTTGCCTCAGCCTCTCAGTTACTGGGATATCCAGCCT
GCTCTACCACACCCCCTCTTTTGGTTTTTCTTCTCTCCTCTTCTTCCTTCTTTGTCTTTCTCTCCCTCCCTCTCTCAGCC
TATCTACCTATCTTAAATGTCCTTCTCTCAAATTACTCCATGTGTCTCCCTTCTTTGCTTTGGGCCCCCAAATCTCTTTA
CCCATTTTCACTTCCTACAAAAAAAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI11243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28093196..28093546 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es