Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_238C12-3
Clone ID CMHD-GT_238C12-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_238C12-3
Sequence
GAAAGTGAAAAAGACTTGGAAGAAGCCGAGGAGTATAAAGAAGCCCGTGTAGTGCTGGATTCCGTAAAGCTAGAAGCCTG
ACATTTTTCTGTATGGGATGTTTTTTTGCATTAAATCCTGGGGTCCATTCTACAATTCATTGTTTTCAGCCACTGCTGTG
TTTAATAATATGAAAACGTGGTTCTTTTTATGCAGTTGCATTTATTTTTCTTTGCATAACTTAATGTGTC
Sequence Type mRNA
Unitrap ID UNI13815

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95612605..95612834 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042043 (Tbca) NM_009321 tubulin cofactor a Gene [Source:MGI Symbol;Acc:MGI:107549]

 
Come back to gene ENSMUSG00000042043


For any suggestions or comments, please send an email to unitrap@crg.es