Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_238B9-3
Clone ID CMHD-GT_238B9-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_238B9-3
Sequence
ACTAGTGGCAAGGATGAGCCCTTCTTTCATCATGGAAACACCAAGGTATCAGCCCAAGATCATGAGGAGACCCTTCTACT
CTGTGGTGCATGATGCTGCTGAGCCATGATCTTCAGTAGAATATGTGTATTATGTGTATTTTGGACTTAAGATATTTTCA
ATTTATGATGAGTTCCTCAGAATGCAAAGCCGTTGTCATCCAAGAATCATCTATATAGAAGAATGTTAGCAGTAATAGAG
TCTAGGTGTTAAGTACATATGCATTTTCACTTTCAACTTTTCTAGATGTTTGAAAATTTTCATAATAAAATGGTGATGTA
TGACTTGGTAAAAATAAACATGGGAAAAGTTCATG
Sequence Type mRNA
Unitrap ID UNI13817

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74130086..74130440 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069189 (Zdhhc11) NM_027704 zinc finger, DHHC domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1918414]

 
Come back to gene ENSMUSG00000069189


For any suggestions or comments, please send an email to unitrap@crg.es