Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14233G8
Clone ID IST14233G8
Vector VICTR74
Project tigm

Sequence tag IST14233G8HMR1
Sequence
GTGGCCTGGAAGAACCGTGTTCCTGGGGGTGGGGGGACAGGCAAACGTGGGCGCTCGCGGAACCGGAAGTANCTGCGGCG
AGGTTCACTCGAGCCTTCCTAGGTTAGCACGTCCTGCACGGAACACACCAGCCCAGTCCCCGGACATTTCTGATAAAGCA
CCACTAATCGATACCCTCAGCCCTCATAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130313328..130313521 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]


Sequence tag IST14233G8BBF1
Sequence
TTTAGAACAGCCACTCACAAGTCANTTTACCATATTTGTTTTCATTTCTTTGTATTCNAAAGTATGGAAGCTACACAATC
GGGAAACTAGATAGATAATTCATTCATAGTTATCCTGTCCGCCCCACCCCTCGCTCTGANACAGGCATACTATCTGTATC
CCCGGATACTCTAAAACTGACTAGGTGGGCCCGGATTCATGGCATTTGTTATCACAGCCAGCACATACCATTTTAAATTT
TTTATCATTTACTTATTATGTGCCTGTGTATCTTGNATATTGTATGTGCTCANCTCTCTGGAANCCNGAAGANGGTGTCT
GATCCCCAGGANCANTATTACAGGACTTTCTAGNCTGTTCANANTANNGGGTCTNANCTTTNNNCCNCANNACAGANCAN
CAAGCNCTCNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026356


For any suggestions or comments, please send an email to unitrap@crg.es