Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13398H1
Clone ID IST13398H1
Vector VICTR74
Project tigm

Sequence tag IST13398H1BBF1
Sequence
AGCTCACCTCTTAGTTCTTTTTTGTTCTCATCTGTAAGGGAACAAAATGCCAATGTGTTAAGTANAAAGTANCGGTGGCT
TCGGATGGAAACAAGGGCTGGACTANACCCCCACCTGANATGGTGGATCTCTGTGCCTGCTGAACTTTCTACATTTCATT
TCTCCNAGTCCAGGGCTTTTAATCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71023982..71024171 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST13398H1HMF1
Sequence
AGCTCACCTCTTAGTTCTTTTTTGTTCTCATCTGTAAGGGAACAAAATGCCAATGTGTTAAGTANAAAGTAGCGGTGGCT
TCGGATGGAAACAAGGGCTGGACTAGACCCCCACCTGANATGGTGGATCTCTGTGCCTGCTGAACTTTCTACATTTCATT
TCTCCAAGTCCAGGGCTTTTAATCTGGATCCATCCCTGCCTGGGATGGGTAGGTGCCAACCTGGANATCCCTGTGGGCAA
GTCTTATCACCCATATCCTGGGGAGCTGCAAAGCTCTGGTTGCCGTGGAAATGAGAGGGTGGGTGGTTTGANGTGNNNCC
TGNCTGNTGGCN
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71023841..71024171 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es