Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_237F12-3
Clone ID CMHD-GT_237F12-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_237F12-3
Sequence
CCTTTAGTGCATCATGCTGCAGCTTCCTGCTTCTACTGCTATGCCTGCCTCATGCAGCCATGCCTCCACACCAGGATGAC
CTCTTATGCTTCTGGAAGTAAAAGCCCCAAAACAATCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGAAGCCTGG
TGATTTATGAAAAAAAATCATAAAACTGCAGCTGGCTGGCCCAGACAGTGAGTGCTCTGTGCATGCCTTTCCCAGTCTTG
ATCCTACTACAAAGCATGGTGAGGAGAACTACAGACTACCTGCCTGGCATCTCTGGGGTAACTTTAGGATTAAAGTCTAG
TGCCCATTTAAAAACTTACTGTTTTGACTTTTCCCCCCAGAAAATAATTTAATCATTGATTTATGGAATTTGATTAATTC
TATATTTTTCATCCTAAAGGTATAATAACTGGTGTTGGAATGTTGCTTTCATTTAATTCTTCCACAATGTATAATGTAT
Sequence Type mRNA
Unitrap ID UNI13820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 16949373..16949705 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055137 (5033411D12Rik) NM_138654 RIKEN cDNA 5033411D12 gene Gene [Source:MGI Symbol;Acc:MGI:1923221]

 
Come back to gene ENSMUSG00000055137


For any suggestions or comments, please send an email to unitrap@crg.es