Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14246H10
Clone ID IST14246H10
Vector VICTR74
Project tigm

Sequence tag IST14246H10BBF1
Sequence
GGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI16255 UNI19455 UNI33833 UNI33834 UNI33835 UNI33836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 43536928..43536984 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22906157..22906213 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041923 (Nol4) NM_199024 nucleolar protein 4 Gene [Source:MGI Symbol;Acc:MGI:2441684]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17947811..17947867 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 46440984..46441040 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022656 (Pvrl3) NM_021495 poliovirus receptor-related 3 Gene [Source:MGI (curated);Acc:Pvrl3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79122984..79123040 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24486772..24486828 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016756 (Cmah) NM_007717 cytidine monophospho-N-acetylneuraminic acid hydroxylase Gene [Source:MGI (curated);Acc:Cmah-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55894540..55894596 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3186673..3186729 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 35005027..35005083 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 30808969..30809025 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 19757634..19757690 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071369 (Map3k5) NM_008580 mitogen-activated protein kinase kinase kinase 5 Gene [Source:MGI (curated);Acc:Map3k5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11563672..11563728 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 12427219..12427275 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032625 (Thsd7a) thrombospondin, type I, domain containing 7A Gene [Source:MGI (curated);Acc:Thsd7a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6823285..6823341 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31598974..31599030 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 83068710..83068766 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028483 (Snapc3) NM_029949 small nuclear RNA activating complex, polypeptide 3 Gene [Source:MGI (curated);Acc:Snapc3-006]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9666882..9666938 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11706428..11706484 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 5078028..5078084 57
NO GENE  


Sequence tag IST14246H10HMR1
Sequence
NACNNGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGTGCCAACAACAC
CCGGCTACACTCCCTTGCTTAAGCTAATGTTTAAAACTGTATGATTGTTTCTGATGTGACTCTGTCCATGCAAGTTCAAG
AGCCTGTACACACCTGGACTGCTTATTCCTTTANAAGCAAGGTCTCTTCCCCAACCTGGGGCTCTAATTTTCTCANTTAA
GGTGGAATCCANCAAGTCCAGGGGATTCTCCAGTCTCCACCTTTGTCANANCANNCTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102032707..102033002 282
 
EST/CDNA Est Name
  AW322990.1 - AI838262.1 - BY326017.1 - BY024965.1 - BY026231.1 - BY026758.1 - BY338889.1 - BY337951.1

 
Come back to gene AW322990.1 - AI838262.1 - BY326017.1 - BY024965.1 - BY026231.1 - BY026758.1 - BY338889.1 - BY337951.1


For any suggestions or comments, please send an email to unitrap@crg.es