Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14934C4
Clone ID IST14934C4
Vector VICTR76
Project tigm

Sequence tag IST14934C4BBF1
Sequence
CCATGAGTCCCAGTTTCTCCACTAGGACAAGGGAAGAACTGGACCTTACTAAAGTGTCTCCAAGCTCCTTTGTCACAGTC
ATGGCAGGCCCCCCTTTCTGGGAAAAGTTTCTAAGTGGCAAAGACATGAACAAAGGTGATGTGTTTAAACAGGAGTAGGA
AGGTCAAAAGTCTGTCCCTGTCCCCACCCTGTCTCTGCCTACACCTCCACACCCAAGACCCTTGTGGTTCANAAATTCCT
GGAATGCTAATCCTTTGTAAAGCCTTCCCTGGCTCCANACAGGCAAGTGCTTCTTTCTTCCCACAGCACAGTCCTCAGGA
ACTCCCTCCACTGCACTGATCNCATGCANCTCCCCTAGGTCCTCACATCAAGGACATGCCCGCTGCCCTGTCACCCACAN
CTTGAGTGTGCTGGGTANATGTGTTGGGAGGTGTN
Sequence Type genomic DNA
Unitrap ID UNI31904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8732843..8733276 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040584 (Abcb1a) NM_011076 ATP-binding cassette, sub-family B (MDR/TAP), member 1A Gene [Source:MGI (curated);Acc:Abcb1a-001]


Sequence tag IST14934C4HMF2
Sequence
CCCCTATGGAAAAAAAAGAAAAAGGTCATTTGACCCCTCCCCCCAAAAGGGTTTCAAGTCACAGGTTGANAACCTCTGTT
CTANAGACTANAGGCCCTGGAACCTTANATCCTTGTGTGTCAGGGCTTCTCATGGAGAAGTGTGTTCTTGGAATGGAGGA
AACCAGGCGTACTANTCATCTAGGACTGTAGCATGTAGGAAGCTGAAGGCANAATTGTTAGTTCAAGACCANCCTANGCC
ACCCTCAAATTAAAAAANCNTTAAATTAN
Sequence Type genomic DNA
Unitrap ID UNI30920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104176132..104176399 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es