Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13926C11
Clone ID IST13926C11
Vector VICTR74
Project tigm

Sequence tag IST13926C11HMF1
Sequence
TTAAGAGGACGTATACAAAAACTCAAAGATCCCGCTGGTAAAAACTGGGCTGAGGTGGAGCTCTGAACATGTGGAGAACG
GGCGGGCGGGGTTGCTGTGCTAGGCCAGATATAGAAAGCTTTCTGTATTTAATACACAGTACATGCATCATTCATGTCTA
CATAATTAAGANAAAGGAAGCTGCATTGTTAATGGGAAAAAAAATAGGGTCTGGGAATGTANTGTGCCTAGCATTTACNA
ACTTCGGGGTTTGGGTTTGATCCCANCC
Sequence Type genomic DNA
Unitrap ID UNI33032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88297514..88297778 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es