Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14666G9
Clone ID IST14666G9
Vector VICTR74
Project tigm

Sequence tag IST14666G9HMR1
Sequence
GCTTTAAAGTANCCTTTTCTCANTGATTTTTTTTTCTGACATTTTATGGGCTTGTTCTTTC
Sequence Type genomic DNA
Unitrap ID UNI10719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28520342..28520401 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]


Sequence tag IST14666G9BBF1
Sequence
TACCAACCCACCTTTGGTGGTCTCGCTTTCCCGAATGAGAAAGGCCCCCTGGGGGTTACCAGAGGACAGAAGCTGCCTCT
CTGCATCCTTTCTACTGATCTTTCCGAAGTACCACCTGTTAGGAAAAGCAGGCAGAACCAGGCACATTCATTCCAAACGC
CAGTTCATCTTCCCCGGAAGTCACCGCAACAGCCAAGTCTCAGTTTCCTCATCTGACAAATGGGTTGTTATANNNTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132550445..132550676 232
 
EST/CDNA Est Name
  DY244401.1

 
Come back to gene DY244401.1


For any suggestions or comments, please send an email to unitrap@crg.es