Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14682D4
Clone ID IST14682D4
Vector VICTR74
Project tigm

Sequence tag IST14682D4HMR1
Sequence
GTGAGAAGCCCTGAGATGGAGCAGTGGAGACTCANACCTTTAATCCCAGCCCTCCCGGTGGCAGAAGCAGGCAGATCTCT
CAAGTTCAAGAACAGCCTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114464525..114464626 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]


Sequence tag IST14682D4HMF2
Sequence
CAACATTATGAACTAACCAGTACTCCAGANCTCTTGACTCTAGCTGCATAAGTATCAAAAGATGGCCTAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103048572..103048643 70
NO GENE  


Sequence tag IST14682D4BBF1
Sequence
CAACATTATGAACTAACCAGTACTCCAGAGCTCTTGACTCTAGCTGCATAAGTATCAAAAGATGGCCTAGTCGACCATCA
CTGGAAAGAGAGGCCCATTGGACTTGCAAACTTTATATGCCCCAGTACAGGGGAACACCAGGGCCAAAAAGTGGGAGTGG
GTGGGTAGGGGAGTGGGGGGAGGGTNTGGGGGNCTTTTGNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103048572..103048770 195
 
EST/CDNA Est Name
  AA116883.1

 
Come back to gene AA116883.1


For any suggestions or comments, please send an email to unitrap@crg.es