Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_237A4-3
Clone ID CMHD-GT_237A4-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_237A4-3
Sequence
CTCTCCACCATGCCCGGGGGCGTACCCTGGTCCGCCTACTTGAAAATGCTTTCCTCCAGCCTCCTGGCCATGTGCGCCGG
GGCCCAGGTGGTGCATTGGTACTATCGGCCTGACCTGACAATACCTGAAATCCCACCAAAGCCTGGAGAACTCAAAACGG
AGCTTTTGGGACTGAAAGAGAGACGCCATGAACCTCATGTTTCACAGCAGTAGAAACTTCAAAATAACAGCTGTGCCAAG
AATTCTGTGAATAATGTTTCAAATATGTATTTTAAAATTTATTAAGTAAAACTGCTTTTTAAAACACCT
Sequence Type mRNA
Unitrap ID UNI13823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 82082772..82085569 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063320 (1190007I07Rik) NP_001129039 RIKEN cDNA 1190007I07 gene Gene [Source:MGI Symbol;Acc:MGI:3698433]

 
Come back to gene ENSMUSG00000063320


For any suggestions or comments, please send an email to unitrap@crg.es