Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710B8
Clone ID IST14710B8
Vector VICTR76
Project tigm

Sequence tag IST14710B8BBF1
Sequence
CAGGCACACGTGTATGCACGCATTCACACCCACCTTCGCCGTGAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 128394181..128394230 50
NO GENE  


Sequence tag IST14710B8HMR1
Sequence
TCATTGCTTATAGTGGTGGGTCANAAAGAGCGAGAAAAAAAACAGTTGAGACAAGTCTCCAGGCATTTTCCTGCGAAGGA
ATCAGATAGATGGGGCAAGAGCTGACGACTGATANAGCTTAAGAAAGGAGAAAACTGGCAGGTCAGTGGTGGCACACACC
GTTAGTCCCAGCACTTGAGACACAGATGCAGGGTCTCTATGAGTTTGAGGCCANCCTGGTCTATAGAGGGAGTTCCAGGA
CAGCCANGAAACCCTGTCTTGGGGAAAAAAAAAAGGGGNNAA
Sequence Type genomic DNA
Unitrap ID UNI3462

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26445499..26445776 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061286 (Exosc5) NM_138586 exosome component 5 Gene [Source:MGI Symbol;Acc:MGI:107889]


Sequence tag IST14710B8HMF2
Sequence
CCTTTAACATCTCAAACAAACTCACCATTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26445434..26445468 35
NO GENE  

 
Come back to gene ENSMUSG00000061286


For any suggestions or comments, please send an email to unitrap@crg.es