Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14640H10
Clone ID IST14640H10
Vector VICTR74
Project tigm

Sequence tag IST14640H10HMR1
Sequence
AATGAACATGATATATGCAGAATACAGGTTGATATGTAAGAAAAGTCGTGTAATAGAAACGTGTAAACCATGGGGTCAGA
GTTCATTCGGTCCTGATGCTATGGGATCCTGGGTAAATTAGATATCTGTGCTTCANTTTCTTTCTCCGGGAGAGAATGTT
CTTCATANGCTANCTTCAGGGATTACNTGANGTCAANTCTATGGNCNTTCTTTN
Sequence Type genomic DNA
Unitrap ID UNI10489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110018466..110018678 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]


Sequence tag IST14640H10HMF1
Sequence
CATTTTTTGAAAGAATAAGTGGGGTCCAAAACTGGATAAAACTTTTTGGACTATAGCTTCATAAATTAAAATATTGAAAA
GTTTGATCTTTGGGTGTCAGGTGGGGTACACCTACATAGAAACTTTGTCAAAGAATATATAAATGTAGAAGTAAAAAGCA
TTATCATAAATCTAAATAATAATATATAATAAAATCAGGAAAGAGTTCTCCTGCCTGGAAATGTCAGACTCTGAGATTTA
AGTATAAATTATAAGATGTAGTCAAGAGGTGCATGGCACATGGCGCTGGGGTCACTGCATTCCAANAAACCGTTGCAAGG
AAAATCATTANAAAAGGTGTAATTTTACTCTGGCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110018675..110019029 351
 
EST/CDNA Est Name
  BB851705.1 - BY274609.1 - CJ151389.1 - AI789271.1 - BY249109.1 - BB846569.1 - BY280970.1 - BB853109.1 - BY240815.1 - BY005995.1 - CJ175657.1 - BB839791.1 - BB840429.1 - BB844242.1 - BY268738.1 - BB856330.1 - BY245829.1 - BY251721.1 - BY255709.1 - BY289464

 
Come back to gene BB851705.1 - BY274609.1 - CJ151389.1 - AI789271.1 - BY249109.1 - BB846569.1 - BY280970.1 - BB853109.1 - BY240815.1 - BY005995.1 - CJ175657.1 - BB839791.1 - BB840429.1 - BB844242.1 - BY268738.1 - BB856330.1 - BY245829.1 - BY251721.1 - BY255709.1 - BY289464


For any suggestions or comments, please send an email to unitrap@crg.es