Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_230C3-3
Clone ID CMHD-GT_230C3-3
Vector pGTNMDi
Project cmhd

Sequence tag CMHD-GT_230C3-3
Sequence
GCAACATAAACAGAAAACCAAAGCCTCAATGCAGTATCAAATTCAACAAATGAGACCTTCTATGAAGCTGACGATGGGAC
TCAAAAGAAAACAATGGATATAACACAAATCAATATTGCCTGTTAGTTAAAATCCCTGTTTTGAAAGTTTATCTGAGAGA
GGGAGCATTAAGAATAAAGAATGAAAAAAAATACAAAAAAGTTAAATAAAAATAAAGAATGCATTTTATTTGTG
Sequence Type mRNA
Unitrap ID UNI13825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 105635908..105636143 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042655 (A930021C24Rik) NM_029984 family with sequence similarity 159, member B Gene [Source:MGI Symbol;Acc:MGI:1925053]

 
Come back to gene ENSMUSG00000042655


For any suggestions or comments, please send an email to unitrap@crg.es