Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_229C8-3
Clone ID CMHD-GT_229C8-3
Vector pGTNMDi
Project cmhd

Sequence tag CMHD-GT_229C8-3
Sequence
CACAAGAATGAAGCAGAGTTCCAGAGGTGGATCATCTGCTGCTGTGGAGCTACGGAGTGTGAGGCCCGCCAGAGCTCCAC
CTGCCTGAAGGAGTGGTGATCCTGTTTCCTATAGATATCTCTGGCCTGGCAGCTCTACCTCAGATAAAGGCTACCCATGC
TACCTACAGAC
Sequence Type mRNA
Unitrap ID UNI13829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143899536..143899706 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037307 (Banf2) NM_207275 barrier to autointegration factor 2 Gene [Source:MGI (curated);Acc:Banf2-001]

 
Come back to gene ENSMUSG00000037307


For any suggestions or comments, please send an email to unitrap@crg.es