Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10668H10
Clone ID IST10668H10
Vector VICTR76
Project tigm

Sequence tag IST10668H10BBF1
Sequence
TTCCGAAGGTCTGGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2661 UNI6996 UNI33506 UNI33850 UNI33851 UNI33852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60859862..60859929 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 109284133..109284200 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 85299563..85299630 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 109997490..109997557 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021699 (Pde4d) NP_035186 phosphodiesterase 4D, cAMP specific Gene [Source:MGI (curated);Acc:Pde4d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 53000051..53000118 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100187418..100187485 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056487 (Higd1c) NM_001002900 methyltransferase like 7A2 Gene [Source:MGI Symbol;Acc:MGI:3026615]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5043152..5043219 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 75151177..75151244 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024078 (Ttc27) NM_152817 tetratricopeptide repeat domain 27 Gene [Source:MGI Symbol;Acc:MGI:1921446]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35133383..35133450 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45969732..45969799 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039901 (9130011E15Rik) NP_938038 RIKEN cDNA 9130011E15 gene Gene [Source:MGI Symbol;Acc:MGI:1918867]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31880267..31880334 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 91827536..91827603 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042244 (Pglyrp3) NM_207247 peptidoglycan recognition protein 3 Gene [Source:MGI (curated);Acc:Pglyrp3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129034015..129034082 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 116284321..116284388 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37799199..37799266 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 31000571..31000638 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4598485..4598552 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50798576..50798643 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7860009..7860076 66
NO GENE  

 
Come back to gene ENSMUSG00000042244


For any suggestions or comments, please send an email to unitrap@crg.es