Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0076
Clone ID AB0076
Vector pGT0lxr
Project sanger

Sequence tag AB0076
Sequence
CCTGGCTCTCTGTTCCTCTCCGTTGCGAGCAAGCTGAAAGATTGGTCTGATGTGTTTTGATCTCTGCTGCCAGGACCCTA
GGGCAATGCCAGCGATCTACAACGTGGCGACATG
Sequence Type mRNA
Unitrap ID UNI2143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62659847..62659957 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074865 (6720457D02Rik) RIKEN cDNA 6720457D02 gene Gene [Source:MGI Symbol;Acc:MGI:1924367]

 
Come back to gene ENSMUSG00000074865


For any suggestions or comments, please send an email to unitrap@crg.es