Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0031
Clone ID AB0031
Vector pGT0lxr
Project sanger

Sequence tag AB0031
Sequence
AAGCCCAGTTCGTTATCTACAGATGTCAAGACGCAGATGATACTCTACCGTCCAGCATTTTTGGGCCAAAGAAAAAGTTC
AAGCCTGTCATTCAAAGGCCACTCCCAAAAGATGTATCCCTGCACAGTGCCCTGATGGAAGCTATCCACTCATCAGGAGG
GAGAGAAAAGCTCCGGAAGACTGCAGAACAGACGTCAGAAGGAAGGCCAAAGAAACCATCCTACGTGGAGGCAGAGAGTG
AGCGATCTGCCCTTCTGGCAGCCATTCGGGGTCACAGTGGGACTCTCAGCCTCAGGAAGGTGTCATCCCTTGCCTCTGAG
GAGCTCCAGAGCTTCCGCAATGCTGCACTCGGGGCTCCAGGTTTGGATAAACCTCAGCAAGAAGACCTTGGCCTTCCACC
CCCACCTGCCCTGCCACCACCACCCGCTCCAGCCCCCCAGGCTCCTTCAGCCTCCGTAACAGTTTCTAGGTTCAGCACCG
GCACCCCCAGCAACTCAGTAAATGCTAGACAAGCCTTGATGGATGCCATCCGCTCGGGCACAGGAGCTGCAAGACTAAGA
AAG
Sequence Type mRNA
Unitrap ID UNI2144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12149653..12153271 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es