Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_226D2-3
Clone ID CMHD-GT_226D2-3
Vector pGTNMDi
Project cmhd

Sequence tag CMHD-GT_226D2-3
Sequence
AGCAACGGGCTTCGGCTTCTTGAACGCCCTCTGTAAAGCGGCGGCCGTCCTGGGAAACTTAATCTTCGGTTCCTTGGTCA
GCATCACCAAAGCCATCCCCATCCTGCTGGCTTCCACTGTGCTCGTGTGTGGAGGACTCGTGGGGCTGCGCCTGCCCGAC
ACACGAACCCAGGTTCTGATGTGACGTGACAAAAGCCATTCCCTTCCTCCCACCGTGGGTCGGTCGTATTGCCTGACTCA
AAGCTTCAGAGTTTTTGTGTATAGAAAGGTGGCCAAGTATCAGAACACAAACTTTTGCTGTG
Sequence Type mRNA
Unitrap ID UNI13839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96731117..96731418 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051111 (Sv2c) synaptic vesicle glycoprotein 2c Gene [Source:MGI Symbol;Acc:MGI:1922459]

 
Come back to gene ENSMUSG00000051111


For any suggestions or comments, please send an email to unitrap@crg.es