Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10184H3
Clone ID IST10184H3
Vector VICTR76
Project tigm

Sequence tag IST10184H3HMF1
Sequence
AAACTACATGCAGCATCCTGAATCCCTTAAGTACATTTGAGGCTCATTTGCCACACTTAAGATGGCGACGACCAGCTTCC
AAGTCGCCCTTTGCGCCACACTAAAAATGGCAACGCACGCGCTATCGCGACTTCCGGTTCCAGTTCCGGTCCCCTAGTCA
GGTCCGGCGGCCTGCACACGCCAAGCACGCTGGGAGTAGCCATGGCGGATAATCCCGTTTTGGAGCTGTTGCTGCGGCGG
CTGGAGGTAGCTGATGGCGGTCTGGACAGCGCGGANTTGGCTACGCANCTGGGTGTGGAGCACCAGGCGGTGGTGGGCGC
AGTGAANAGCCTTCAAGCTCTGGGTGAGGTGAGTCCAGGCGTGCCGCGGCTCGGCCTCGCTTTCATACCGGCAGCNNNAT
TATTTCTGGTGAANGGACATTACGTGCTGGTGCACCGTGGGGTGCGCTGGTGGGAAGTCTGGAACANTTTTCGTTTCTNA
AGTGACTAATGTCTGNTAANGCGAAAAN
Sequence Type genomic DNA
Unitrap ID UNI33854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87380733..87381239 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003808 (Farsa) NM_025648 phenylalanyl-tRNA synthetase, alpha subunit Gene [Source:MGI (curated);Acc:Farsa-001]

 
Come back to gene ENSMUSG00000003808


For any suggestions or comments, please send an email to unitrap@crg.es