Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0160
Clone ID AA0160
Vector pGT0lxr
Project sanger

Sequence tag AA0160
Sequence
CTCTTATCTATCTTTTTTCTTTTTCGTCTCTCCTTTCCGTTCCTCAGCTCCCCACAATTCATCATTTGTTTCATTTCTCT
CTGCACCTGGTGTGAGCATCATTAACCTTTTAGTACTTTTTTTTCATGCTGCCCCCTGCCTTTCGCTCGTTATATTCCCT
CTCGTTCTCCGGTTCATATTGGCTTCTGGACTCGCTTTTTTTGGACACGCCCTTGGATCCTTCTATTTAAAGGACGGAGG
CTTATGAGTATGCTCAGTCCCTTGGGGCACATACCTGTTCCTTACCTAACTTCCAGGTGTTTAAATTCATCTACTTGTGC
CGCCTGGCTGAAATGGGACTTGCCACACAGGCCTTCCACTACTGCGAAGTAATAGCCAAGAGTGTCCTGACACAGCCTGG
TGCATACTCTCCAGTACTGATTAGCCAGTTGACTCAG
Sequence Type mRNA
Unitrap ID UNI2146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26279937..26280785 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026924 (Sec16a) NM_153125 SEC16 homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec16a-001]

 
Come back to gene ENSMUSG00000026924


For any suggestions or comments, please send an email to unitrap@crg.es