Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14469B12
Clone ID IST14469B12
Vector VICTR74
Project tigm

Sequence tag IST14469B12HMR1
Sequence
CNTTAAATTATNNTTCATCATTGTTTTGTATATGGGCTCCTGTGGGTCTGGTTTAGCCTGAAATCACTAAGGGTCATGAA
CAGCTATAGAACAATAGCTCAACTTTCTGATCATCTATAATGACAGAGGGAGCTCTAGAGCATGGGGCCTCTCTGTTCAN
AAGACAGATCAGTAGTAACTAGGGTCAAATTTATAACC
Sequence Type genomic DNA
Unitrap ID UNI14331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177102915..177103109 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078868 (OTTMUSG00000016580) predicted gene, OTTMUSG00000016580 Gene [Source:MGI Symbol;Acc:MGI:3652251]


Sequence tag IST14469B12HMF1
Sequence
ATGTCTGCTTCCTGCCATATGCATTACATTCCAATCTATCCTATCCACCCACCCAGCACCATCAACACCTGANAAACTTC
TGCATTTCAGAAGCTCCTTTTGTAACCAAGAATTGAATTTCTGTGAATCATGCCATTTTGACAATAGGTAACAGAAAGGT
AAAAGGAATCTAATCAAATATTTCTGAAGGATGATCACTGTCAGATCTTTACAACTAACTTCTACACTATAAAATTAGTC
ACACAAACCTGAATACGGAAGGGTCAAGAATTCTAGAAATCAAACCATTACTTTTCCAATGCTGTCCTATGGCACACCAA
ANGCAATTCCTGTATATACACACTGCATANTGACATTTAANTTCCATACATTCNNNCTCCCANTGCTACTGANCNACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177103109..177103507 377
NO GENE  


Sequence tag IST14469B12BBF1
Sequence
ATGTCTGCTTCCTGCCATATGCATTACATTCCAATCTATCCTATCCACCCACCCAGCACCATCAACACCTGAGAAACTTC
TGCATTTCAGAAGCTCCTTTTGTAACCAAGAATTGAATTTCTGTGAATCATGCCATTTTGACAATAGGTAACAGAAAGGT
AAAAGGAATCTAATCAAATATTTCTGAAGGATGATCACTGTCAGANCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177103109..177103316 206
NO GENE  

 
Come back to gene ENSMUSG00000078868


For any suggestions or comments, please send an email to unitrap@crg.es