Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_225C1-3
Clone ID CMHD-GT_225C1-3
Vector pGTNMDi
Project cmhd

Sequence tag CMHD-GT_225C1-3
Sequence
GCGTCCTCGGGAAAGGTCGCTATTTTTACTATGGAAGAAATTCAGAGGGTAACAGGTTTATCCGAGATGATCAGCTCTGA
AGCTAAACTCTGCACGCCTTAGCCTGTTTCATGACAATAAAGTGGAAAAGC
Sequence Type mRNA
Unitrap ID UNI13814

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 23875177..23875307 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063458 (1700112E06Rik) RIKEN cDNA 1700112E06 gene Gene [Source:MGI Symbol;Acc:MGI:1923883]

 
Come back to gene ENSMUSG00000063458


For any suggestions or comments, please send an email to unitrap@crg.es