Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10042E4
Clone ID IST10042E4
Vector VICTR75
Project tigm

Sequence tag IST10042E4BBR1
Sequence
GCGTTTACTGGCTTAGATTGTATAGGTTAGAGAACCTTTCCGTCCCTGTAGAAAATTCTACTGGACAGTACTGATCTGGA
TGGTGGGGGTCAGGGTGGCATTGAGGACAGGCCAAAGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI26771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97527925..97528046 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es